ER-localized protein-Herpud1 is a new mediator of IL-4-induced macrophage polarization and migration
Abstract:
ER-localized proteins have been reported function in endoplasmic reticulum, unfolded protein degradation and destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system, but their function in the chemotaxis of macrophage cells remained un-addressed. Here, we showed that ER protein with ubiquitin like domain 1(Herpud1) was upregulated in IL-4-treated M2 macrophage cells and its expression pattern was similar with macrophage polarization markers, such as Arg1, Mrc1 and Fizz1. Inhibition of Herpud1 by using specific target shRNA decreased these marker’s expression at mRNA and protein level in IL-4-treated or -untreated M2 macrophage cells. IL-4 treatment promoted M2 macrophage cell migration and polarization, but this promotion was weakened by Herpud1 depletion and we got similar results by inhibition of ER stress response with chemical molecule 4-phenylbutyric acid (4-PBA) in IL-4-treated or untreated-M2 macrophage cells with Herpud1 overexpression. These results indicated that depending on ER-associated protein degradation (ERAD) to help unfolded protein degradation or destruction is not the only function of Herpud1 and acting as a mediator of IL-4 induced macrophage activation and polarization maybe another unrevealed function, elucidating the role of Herpud1-associated M2 macrophage cell polarization and activation are helpful for exploration the function of macrophage cells in immune response.
Keywords: Herpud1, IL-4, Macrophage polarization, Macrophage migration.
1. Introduction
Endoplasmic reticulum (ER) is an intracellular organelle which is important for protein synthesis, folding and maturation or quality control in eukaryotic cells [1]. Under normal conditions, ER protein loading and folding exhibit dynamic equilibrium, once cells are stimulated by genetic or environmental factors, this balance will be disrupted and lead to the accumulation of misfolded proteins in ER, this process are called ER stress [2, 3]. ER stress has been reported to function in IL-4 induced M2 macrophage polarization and migration [4], but little evidences explained how ER stress function in this process.
Macrophages are a part of the innate immunity system and act as vital effectors and regulators in immune system [5]. It is well known that macrophages can differentiate into M1 and M2 macrophages in the process of completing their function [5-8]. After decades of efforts, IL-4 as a key inducer of macrophages differentiated into M2 has been widely accepted [9].When macrophage cells are stimulated by IL-4, some transcriptional factors (e.g., c-Myc, Stat6, KLF4) has been activated and then triggered a series of signaling pathways [6, 10]. Once these signaling pathways are activated, the morphology and migration of macrophage will be changed accordingly. Polarity is a typical characteristic of macrophages after signal transduction pathway changes under IL-4 stimulation [11]. Stimulation of macrophages with IL-4 can induce high expression of M2-associated genes, such as mannose receptor 1 (Mrc1) and arginase 1 (Arg1) [6]. Based on the previous studies, these two genes can be used as the markers of M2 macrophage polarization [12, 13]. Although IL-4 stimulation induces M2 macrophage polarization and Mrc1 and Arg1 have been proved in this process, finding new regulators that function in IL4-mediated Mrc1 and Arg1 up-regulation is still important for understanding how macrophages take part in tissue repair and antiinflammation response. Homocysteine inducible ER protein with ubiquitin like domain 1 (Herpud1) which is an ER-localized protein has been described as a target in the unfolded protein response (UPR) because it can response to various stressors and help the retro-translocation of proteins from the ER to the 26S proteasome[14, 15]. Although its ER-stress activation function has been evidenced, the role of Herpud1-mediated ER-stress in IL-4-leaded polarization and migration of M2 macrophages remained unexplored.
Here, we found that overexpression of Herpud1 promoted IL-4-induced M2 macrophage polarization and migration and got reverse results in Herpud1-knockdown cells. We further demonstrated that inhibition of Herpud1-associated ER stress response with chemical molecular (4-PBA) attenuated IL-4-promoted macrophage polarization and migration. These findings indicated that Herpud1-activated ER stress response maybe a necessary component of chemotactic factor activated signaling pathway, at least in IL-4-induced macrophage polarization and migration.
2. Materials and Methods
2.1. Cell Culture and Transient Transfection
Raw264.7 macrophage cell lines were supported by Roswell Park Memorial Institute (RPMI) 1640 (Gibco, Carlsbad, CA) containing 10% fetal bovine serum (FBS, Bioind, Israel) and 1% penicillin-streptomycin (Sigma-Aldrich, Darmstadt, Germany) at 37°C and 5% CO2 in an incubator. Lipofectamine 2000 (Invitrogen, Grand Island, NY, USA) was used as transfection reagent. 3ug of control vector pCMV-2B-tag, pCMV-2B-tag-Herpud1 (Herpud1-OV) plasmid, negative control-shRNA-pLKO.
1 (NC-shRNA) plasmid and pLKO.1-shRNA-Hepud1 (shHerpud1) plasmid were transfected into Raw264.7 cells in each well of 6 wells plates for 24h or 72h. And the ratio of Lipofectamine 2000 and plasmid was 2:1. Replace fresh medium after 8h. To explore function of Herpud1 in progress of IL-4-activated M2 macrophage, 5% BSA (sigma, St. Louis, MO, USA) diluted IL-4 (20ng/ml. sigma, St. Louis, MO, USA) was used for treating cells for 8h before cells were collected. 4-PBA (5mM/ml; J&K Scientific, Beijing, China) was added into above medium for 12h. The cells were used for western blot or RT-PCR.
2.2. Plasmids Construction
Herpud1 CDS (accession number: NM022331) was inserted into pCMV-tag-2B between restriction sites HindIII and BamHI. Herpud1 knockdown sequence was inserted into vector pLKO.1 with restriction sites AgeI and EcoRI. shHerpud1 is aimed at CDS region. List of overexpression and knockdown of primers are shown below: Herpud1-OV-F:5’AGACGCCAAGTGTCGTTGTG 3’; R:5’ TCAGTTGGCTAGGGCTGGT 3’. shHerpud1-F: 5’CCGGCGTTATTCTGAAGAGCTTTAACTCGAG TTAAAGCTCTTCAGAATAACGTTTTTG 3’; R: 5’AATTCAAAAACGTTATTCTGAAGAGCTTTA ACTCGAGTTAAAGCTCTTCAGAATAACG 3’. NC-shRNA-F: 5’ CCGGCTTCTCCGAACGTGTC ACGTCTCGAGGAAGAGGCTTGCACAGTGCATTTTTG 3’; R: 5’AATTCAAAAACTTCTCCGAA CGTGTCACGTCTCGAGGAAGAGGCTTGCACAGTGCA 3’.
2.3. RNA Extraction and Real-Time PCR (RT-PCR)
Total RNA was extracted from Raw264.7 cells following Trizol® (Invitrogen, Grand Island, NY) methods’ protocol. 2µg total RNA was selected to take part in reverse transcription by using the First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instruction. The 1uL cDNA as a template was mixed into standard PCR reactions containing Ultra SYBR Mixture (Com Win Biotech, Bei Jing, China). And the expression levels of Herpud1, Arg1, Mrc1 and Fizz1 were compared with 18S mRNA. The housekeeping gene 18S was regarded as an internal control for each sample. Reactions were run by Bio Rad System. The relative expressions of genes were calculated by the comparative cycle threshold (CT) method compared with 18S. List of primers used for RT-PCR: Herpud1-F: 5′ GTTGGATTGGACCTATTCCG 3′; R: 5′ CTCT GTCTGAACGGAAACCA 3′. Arg1-F: 5′ GTGAAGAACCCACGGTCTGT 3′; R: 5′ CTGGTTGTCGGGGAGTGTT 3′. Mrc1-F: 5′ AGAGCCCACAACAACTCCTG 3’; R: 5′ TCCACTGCTCGTAATCAGCC 3′. Fizz1-F: 5′ GAGACCATAGAGATTATCGTGGA 3′; R: 5′ CACACCCAGTAGCAGTCATC 3’.18s-F: 5′ GTAACCCGTTGAACCCCATT 3′; R: 5′ CCATCCAATCGGTAGTAGCG 3′.
2.4. Protein Extraction and Western Blot Analysis
Raw264.7 cells were collected and dissolved by radio immune precipitation (RIPA) buffer (Beyotime, Shanghai, China). Protein concentration was detected by the bicinchoninic acid (BCA) protein assay reagent kit (Thermo Fisher Scientific, Waltham, MA, USA). The protein samples (20ug each lane) were added into 12% SDS-PAGE gel. And then they were transferred to nitrocellulose membrane (Millipore Corporation, Billerica, MA, USA). And nitrocellulose membrane was blocked for 2 h at room temperature by 5% fat-free milk that was dissolved in tris-buffered saline containing 0.1% Tween-20 (TBST). And TBST washed above membranes three times for 5 min each time. Then nitrocellulose membranes were incubated by the corresponding primary antibody at 4°C overnight, such as anti-Arg1 (1:2000, Proteintech, Chicago, IL, USA), anti-Mrc1 (1:2000, Proteintech, Chicago, IL, USA), anti-Herpud1 (1:500, Proteintech, Chicago, IL, USA), anti-β-actin (1:1000, Proteintech, Chicago, IL, USA), anti-GRP78 (1:1000, Proteintech, Chicago, IL, USA), anti-eIF2α (1:1000, Proteintech, Chicago, IL, USA). These antibodies were diluted by TBST with 3% BSA (sigma, St. Louis, MO, USA) and 0.02% Sodium azide (NaN3). The membranes were incubated with secondary antibody horseradish peroxidase (HPR)-conjugated goat anti-mouse IgG (1:3000, Proteintech, Chicago, IL, USA) and goat anti-Rabbit IgG (1:3000, Proteintech, Chicago, IL, USA) for 2h at room temperature. Chemiluminescent HRP substrate reagent (Millipore Corporation, Billerica, MA, USA) was used for detecting protein bands by an ECL-plus detection system. β-actin was utilized as a control internal reference for protein samples. Protein bands analysis was performed by Image J 5.0 software (National Institutes of Health, Bethesda, MD, USA).
2.5. Scratch Wound Healing Assay
Raw264.7 cells were cultured in 6-well plates with RPMI1640 medium containing10% FBS and 1% penicillin streptomycin. When cell confluence reached 40%-50%, 3ug plasmids were introduced into cells. when cell confluence reached 70%-80%, cells were washed with PBS, and were cultured with RPMI1640 medium with 1% FBS for 6 h. Using a yellow pipette tip generates scratch wound and the monolayer cells were scraped when cells reached 90%. Then each well was washed with PBS to wipe off cell debris. And if experiments need to add IL-4, IL-4 was added to medium for 8h. Cells were incubated in complete culture medium with 1% FBS at 37°C, 5% CO2. At different time points (0h, 12h and 24 h) cells were used to take a picture by a fluorescence microscope (ECLIPSE Ti-s, Nikon, Tokyo, Japan). Images were collected from six independent fields in each sample. And the wound area was calculated by Image J 5.0 software (National Institutes of Health, Bethesda, MD, USA).
2.6. Statistical Analysis
All experiments were carried out at least three times. All data was presented as the mean ± S.E.M. Student’s t-test from GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla CA, USA) was taken advantage of analysis of two independent experience groups. For all tests, P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) was considered as statistical significant difference.
3. Results
3.1. Herpud1 is up-regulated in IL-4-induced macrophage polarization
It is reported that Arg1, Mrc1 and Fizz1 are macrophage polarization markers and elevation of their expression indicates macrophages differentiate into M2 type macrophage successfully [3]. To determine the function of Herpud1 in the process of IL-4-stimulated macrophage polarization, RT-PCR or western-blot was employed to compare the expression level of Herpud1 and macrophage polarization markers (Arg1, Mrc1, Fizz1) after IL-4 (20ng/ml) with BSA (5%) or BSA (5%) treats Raw264.7 cells at different time points. These results showed that the expression of polarization markers genes Arg1, Mrc1, Fizz1 was increased with IL-4 treatment time extension (Figure 1A-C). To our surprise, Herpud1 was also significantly up-regulated in IL-4 treated Raw264.7 cells and the amount of its expression was further enhanced as the treatment time elongation (Figure 1D). We got similar results on Herpud1 protein level by western blot assay and protein relative quantitative analysis was also performed by scanning gray value (Figure 1E). Given the important role of IL-4 in macrophage differentiation and polarization, we suppose that Herpud1 is a mediator of IL-4-induced macrophage morphology change and we will go further to explore the role of Herpud1 in Raw264.7 polarization and migration.
3.2. Herpud1 is a key regulator of IL-4-induced M2 macrophage polarization
To make clear the association of Herpud1 and M2 macrophage polarization, we further analyzed the mRNA and protein levels of macrophage polarization markers Arg1, Mrc1, Fizz1 after Herpud1 overexpression or inhibition in Raw264.7 cells. In Herpud1 knockdown cells, Arg1, Mrc1 and Fizz1 were significantly decreased in comparison with negative control cells at mRNA and protein levels (Figure 2A, B), their expression was increased in Herpud1 overexpressed-cells (Figure 2C, D). These results suggested that Herpud1 can induce macrophage polarization and maybe act as a mediator in the process of IL-4-stimulated macrophage polarization and activation. So, we further tested the expression of macrophage polarization markers after Raw264.7 cells treated with IL-4 (20ng/ml) and Herpud1 overexpression vector. RT-PCR and western blot results showed that knockdown of Herpud1 inhibited the expression of Arg1, Mrc1 or Fizz1 that were induced by IL-4 in Raw264.7 cells (Figure 2E, F), and Herpud1 promoted the expression of polarization marker genes in IL-4 treated Herpud1-overexpressed cells compared with IL-4 treated cells (Figure 2G, H). These results suggest Herpud1 is a key mediator of IL-4-induced M2 macrophage polarization.
3.3. Herpud1 promotes the migration of macrophages
Polarization is an important characteristic of migratory macrophage. Here, we find that Herpud1 is a new mediator of IL-4-activated macrophage polarization, but the function of Herpud1 is unclear in macrophage migration. To explore the role of Herpud1 in macrophage migration, wound healing assay was applied to value the effect of it in macrophage migration. Knockdown of Herpud1 significantly down-regulated Raw264.7 cells migration (Figure 3A, B, C), and we got reversible results in Herpud1 overexpressed-Raw264.7 cells (Figure 3D, E, F). These results indicated that Herpud1 may play a crucial role in macrophage migration, and Herpud1 induced ER-stress may function in this process.
3.4. Herpud1 elevates ability of IL-4-promoted macrophage migration.
To further confirm the effect of Herpud1 on IL-4-induced macrophage migration, we detected the cells migration in Herpud1-overexpressed or -depleted Raw264.7 cells treated with IL-4 or BSA. In Herpud1 depleted Raw264.7 cells, cell migration was partially inhibited compared with negative control cells after treated with IL-4 (Figure 4A, C). In Herpud1 overexpressed-Raw264.7 cells, cell migration was enhanced in compare with IL-4-treated Raw264.7 cells (Figure 4D, F). Herpud1 expression was detected by western blot (Figure 4B, E).
3.5. Herpud1-associated ER stress is essential for IL-4 induced macrophage polarization and migration
According to above results, we can conclude that Herpud1 is one mediator of IL-4 activated macrophage cell migration and polarization, but whether Herpud1-associated ER-stress also function in these processes remained unaddressed. To solve this question, we inhibited ER stress by using a small molecule compounds 4-PBA, one inhibitor of ER stress [16]. Our western blot results showed that Herpud1 overexpression increased the expression of some ER stress markers (GRP78 and eIF2α) [17] and macrophage polarization markers (Mrc1 and Arg1), but this increasing can be inhibited by 4-PBA (5mM/mL) (Figure 5A, B). Further, we treated Herpud1-overexpressed Raw264.7 cells with IL-4 (20ng/mL), or 4-PBA, or both, and got similar results (Figure 5D, E). These suggested that Herpud1-associated ER stress maybe function in macrophage polarization and migration. Moreover, ER stress inhibition decreased the migration of Herpud1-overexpressed Raw264.7 cells with or without IL4 stimulation (Figure 5C, F and Figure 1S A, B). Moreover, we further analyzed the effect of 4-PBA on microphages migration, results showed that 4-PBA decreased microphages migration and weakened the promotion of Herpud1 overexpression (Figure 1S C). These results demonstrated that Herpud1-associated ER stress played an essential role in IL-4 induced macrophage polarization and migration.
4. Discussion
ER stress is caused by many accumulated unfolded or misfolded proteins which are formed due to the dysregulation of translation in normal physiology condition or various diseases or environmental factors induced in pathology [18, 19]. It has been reported to function in cell proliferation, apoptosis and autophagy [20-22]. After decades study, the mechanism of ER stress initiation is gradually clear, but exploration the other function of some ER-localized proteins that are involved in this process is important for investigator to analysis the role of ER in physiology or pathology condition. Here, we demonstrated that ER-localized protein Herpud1 is induced by IL-4 in macrophage cells and promoted macrophage cell polarization and migration with or without IL-4 stimulation, however, this promotion could be counteracted by knockdown of Herpud1 or inhibition of ER-stress response with chemical molecular 4-PBA. Moreover, Herpud1 promoted macrophage cell migration and polarization can be inhibited by 4-PBA. All these findings suggested that ER-stress associated protein Herpud1 may act as an important mediator of IL-4 activated macrophage differentiation and polarization and migration and ER-stress response may also play a crucial role in these processes.
IL-4 is produced by activated T cells and has been demonstrated to induce M0 macrophage to differentiate into M2 macrophage [23]. Many signaling pathways involved in this process are activated and thus lead to the re-arrangement of cytoskeleton. For example, MAPK signaling pathway is a classical pathway that function in cell proliferation and actin assembly regulation [24, 25], Notch signaling pathway has also been suggested to function in cell polarization and M2 macrophage polarization [26]. In the report of recent studies, IL4 were used as an inducer in M2 macrophage polarization study model [27]. However, how IL4 activated this process remained unclear. Some studies evidence that IL4 can activate IRE1α/XBP1 signaling pathway to promote cathepsin secretion by cooperation with IL-6 and IL-10 in macrophage [28]. It is reported that IL-4 enhances the ER stress response by up-regulation of ER stress markers IRE1 and GRP78 [4]. Some ER-localized proteins, such as Chop, GRP78 and XBP1, their expression is also upregulated by IL-4 in naïve B cell [29]. All these studies indicate that IL-4 can activate ER stress response by regulation of ER-localized proteins. Here, our results further show that IL-4 induced Herpud1 and some polarization markers expression in M2 macrophages. Based on the predecessors’ research, we speculated that IL-4 activated ER stress has tightly association with polarization in macrophages and this speculation was proved by western and RT-PCR results, these results suggested that depletion of ER stress responded-protein Herpud1 can partially inhibit IL-4 promoted polarization markers’ expression. Once we used ER stress inhibitor 4-PBA to deal M2 macrophages, we obtained similar results. Combined with publications and our results, we can conclude that Herpud1 played a crucial role in IL-4-induced M2 macrophage polarization.
Endoplasmic reticulum (ER) is important for protein synthesis, folding and maturation or quality control in eukaryotic cells, and recent researches demonstrate that ER stress contribute to immune response by promotion of Th17 cells differentiating into Th1-like cells [30]. Moreover, ER stress has been reported to function in EMT process of lung adenocarcinoma cells and polarization of M2 macrophage [31, 32]. ER stress related protein Chop activates M2 macrophage polarization by regulation of IL-4-STAT6 signaling pathway [33]. This report indicate that ER stress associated proteins may play an important role in macrophage polarization, here, our study demonstrated another ER stress related protein Herpud1 is involved in IL-4 induced macrophage polarization and cell migration. Inhibition of ER stress with 4-PBA or knockdown of Herpud1 decreased IL-4 promoted M2 macrophage polarization and cell migration. This finding suggest that the function of ER-stress associated proteins is far more than ER stress regulation, may be an important component of signaling pathway.
5. Conclusion:
Here, we found ER stress related protein-Herpud1 is a new regulator of IL-4 activated M2 macrophage migration and polarization and ER stress response may play a crucial role in this process. These findings indicated that depending on ER-associated protein degradation (ERAD) to help unfolded protein degradation or destruction is not the only function of Herpud1 and acting as a mediator of IL-4 induced macrophage activation and polarization maybe another un-revealed function, elucidating the role of Herpud1-associated M2 macrophage cell polarization and activation are helpful for exploration the function of macrophage cells in immune response.